Ly6g5b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGACTTCTGGTCCTTCCCT and CTACTGTTCGCTTCCACGTA, which resulted in a 365 bp deletion beginning at Chromosome 17 position 35,114,431 bp and ending after 35,114,795 bp (GRCm38/mm10). This mutation deletes 365 bp from ENSMUSE00000932901 (exon 3) and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 2 amino acids later. (J:188991)