This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGTCAGCCTGCTAATGTG and GAACTACAGGAGTTCTAACG, which resulted in a 2241 bp deletion beginning at Chromosome 19 position 8,932,972 bp and ending after 8,935,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621540, ENSMUSE00000621539, ENSMUSE00000621538, ENSMUSE00000621537, ENSMUSE00000621536, and ENSMUSE00000621535 (exons 5-10) and 1601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 127 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count