This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAGAATAGAGATGTCCAT and GCATCTCTCCACGAATGCAG, which resulted in a 928 bp deletion beginning at Chromosome 1 position 106,995,664 bp and ending after 106,996,591 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240769 and ENSMUSE00000253941 (exons 4 and 5) and 681 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 74. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count