CRISPR/cas9 genome editing is used to select Guide RNA [CATCCTGCGCATCCTGAAGT] and donor DNA to insert an R312H point mutation (arginine to histidine, NM_004975.2:c.935G to A). THe R312H variant has been identified in children with developmental and epileptic ecephalopathies (DEEs). (J:331047)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count