CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting GGACCGGGATGATGTCAACG) and ssODN template (CTCAGAGAGAAGCATGAGTTTAGGTGGCAGGGTCTGGTGGCAGCAGGGGGCTCTTACTTcTGcAGAAAGACgATCTCgACGTTGACATCATCCCGGTCCTTGTGCAGAAAGTCCTTCAGG) to change histidine codon 444 (CAC) in exon 10 to glutamine (CAG) (ENSMUSP00000153247:p.H444Q, ENSMUST00000145596:c.1332C>G). This mutation is associated with paroxysmal non-kinesigenic dyskinesia (PKND3) with or without epileptic seizures in KCNMA1-linked channelopathy patients. (J:330716)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count