Serpine3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGATGGCTCCCTAAGACA and TAGAATAGACTCAAACTCCA, which resulted in a 593 bp deletion beginning at Chromosome 14 position 62,674,033 bp and ending after 62,674,625 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000883429 (exon 5) and 394 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 231 and early truncation 8 amino acids later. (J:188991)