This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGATAGGAGGAACAGC and AGAGGGACTGCTGTGCTCTC, which resulted in a 317 bp deletion beginning at Chromosome 14 position 20,077,304 bp and ending after 20,077,620 bp (GRCm38/mm10). This mutation deletes 317 bp from ENSMUSE00000413605 (exon 2) and is predicted to cause a change of amino acid sequence after residue 78 and early truncation 48 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count