This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCCTTAACACTATGGCA and ACCGGAACCCCACTCACACG, which resulted in a 2150 bp deletion beginning at Chromosome 8 position 94,136,987 bp and ending after 94,139,136 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635105, ENSMUSE00000212736, and ENSMUSE00000635102 (exons 1-3) and 1752 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count