Myoz3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGGCATTGGTGACAGGCG and ATTTGACCATTACCACCTAA, which resulted in a 619 bp deletion beginning at Chromosome 18 position 60,579,121 bp and ending after 60,579,739 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355110 and ENSMUSE00000343269 (exons 4 and 5) and 429 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 5 amino acids later. (J:188991)