A G>A mutation was engineered in the Tenm1 cis-regulatory element (CRE) using an sgRNA (targeting AATATTATTAGCCACACATTTGG) and a ssODN template (TAAGATGGATTCATATTAGGGCTCAAATGCATTGATAGCATTCTACATATTTTTATCCATTTTTATTCCAAGCTACTTTTATCCAAATAGTTATAGACACAAGGTTATTGCAAATTGTATTTGTCTGCTGCCATAGTGCTTTCTATTTTAGAGGAGTAGAAGTAACTATCTCCTTAACAA) with CRISPR/Cas9 technology. The mutation mimics one found in some families with individuals presenting with X-linked intellectual disability (XLID). (J:308813)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count