An enhancer cluster containing Grem1 limb regulatory regions Rr287 (CRM5) and Rr286 (CRM7), located in Fmn1 introns 12 and 6 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting TTCAGCTGCATTGCGTCCTA and AGTCAAGGACACACGCTGTA) using CRISPR/Cas9 technology, resulting in a 34.3 kb deletion (chr2:113402655-113436919 GRCm39) from intron 6 to 12 (so including exons 7-12). (J:312378)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count