An enhancer cluster containing Grem1 limb regulatory regions Rr285 (CRM2), Rr284 (CRM3) and Rr26 (CRM4), located in Fmn1 introns 15 and 13 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting CACCGTGGCTTACCAGACTAGCGGT and CACCGAATGGTCTGATCGCCA) using CRISPR/Cas9 technology, resulting in a 71.2 kb deletion (chr2:113467121-113538319 GRCm39) from intron 13 to 16 (so including exons 14-16). (J:312378)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count