Grem1 limb regulatory region Rr285 (CRM2), located in Fmn1 intron 15 [in reference to ENSMUST00000081349], was targeted with sgRNAs (targeting AGCGGCAGTTCGGCTTCCGG and TCTCATACGATCCAGGAGAA) using CRISPR/Cas9 technology, resulting in a 9.9 kb deletion (chr2:113519948-113529818 GRCm39) from intron 14 to 15 (so including exon 15). (J:312378)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count