CRISPR/cas9 genome editing is used to remove the Sp7 enhancer (chr15:102207224-102208686, mm9) region using single guide RNA target sequences anking the enhancer (50 sgRNA-1: ggcatctccaccgcttacgctgg; 50 sgRNA-2: ccaccgct tacgctggccacct; 30 sgRNA-1: ccaagaagttagacggggatggg; and 30 sgRNA-2: gggtggtatcccgttatttttgg). (J:328555)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count