Smim22^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTGTGTACGGCCAGAAAG and ACTGTGTTCTAATCCCGCCA, which resulted in a 643 bp deletion beginning at Chromosome 16 position 5,007,697 bp and ending after 5,008,339 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000997341, ENSMUSE00001018238, and ENSMUSE00001086134 (exons 2,3,4) and 296 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)