This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCATGGATGGTCTACTCCA and GATGAACAAATGGTTAATGC, which resulted in a 4149 bp deletion beginning at Chromosome 7 position 46,727,816 bp and ending after 46,731,964 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000204208, ENSMUSE00000204214, ENSMUSE00000353026 (exons 2-4) and 2228 bp of flanking intronic sequence including the start sit, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count