B4galnt4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTGAGAGGATCACCAGA and AACATGGGCGAGGGTCAGGA, which resulted in a 1998 bp deletion beginning at Chromosome 7 position 141,063,569 bp and ending after 141,065,566 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000526246, ENSMUSE00000526245, ENSMUSE00000411875, ENSMUSE00000378279, ENSMUSE00000367568, ENSMUSE00000375760, and ENSMUSE00000350598 (exons 2-8) and 1363 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 13 amino acids later. (J:188991)