Cops9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTGATAAAGAGGCTAGG and CTAAACAGTAGCCATTCGGA, which resulted in a 5306 bp deletion beginning at Chromosome 1 position 92,636,893 bp and ending after 92,642,198 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001311837, ENSMUSE00001274912, and ENSMUSE00001239788 (exons 1-3) and 4868 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 10 bp insertion (CATCCTAAAC) 7 bp before the deletion. (J:188991)