CRISPR/cas9 endonuclease-mediated genome editing ses guide RNAs to target intron 1. A double stranded DNA plasmid donor carrying 394 nt of human intron 1 genomic DNA (including 2.0kb and 1.5kb of mouse Stmn2 intron 1 DNA flanking the 394 nt human derived genomic sequence), was used in combination with mouse Stmn2 intron 1 targeting guides CACAGAATACATATCCTCAGAGG and AAAAATATTAAGCATTCACTGGGresulting in the replacement of 479 nt of murine Stmn2 intron 1 with the human-derived replacement to generate a partially humanized mouse. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count