CRISPR/Cas9 methodologies use a gRNA (TCACGTGGTTATAGAGCTGCAGG) spanning the Stop TAG codon to introduce a fluorescent protein fused to the endogenous gene. EmiRFP670 (derived from miRFP670) is a constitutive, enhanced, monomeric, near-infrared protein whose emission maximum is 670 nm. The donating laboratory confirmed that a single copy of the fusion reporter was integrated. (J:329201)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count