CRISPR/cas9 genome editing uses guide RNAs (AGCGGGTTCATGTCGCCCTC) to create an ATG to ATA mutation, resulting in a methionine to isoleucine change, in the start codon of the third upstream open reading frame (uORF3, analogous to human uORF2). A silent protospacer adjacent motif (PAM) site mutation was introduced to prevent gRNA editing of the donor template. (J:330527)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count