The GG2-GG1/A2-C1 enhancer element of the Ins2 promoter was targeted with sgRNAs (targeting CTTTCTGCAGACCTAGCACCAGG and AAACTGCAGCTTCAGCCCCTCTGG) using CRISPR/Cas9 technology, resulting in a 15 bp deletion (CCAGGGAAGTGTTTG) that removes the GG2 and a small part of the GG1/A2 element. (J:312429)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count