Serine codon 62 (AGC) in exon 2 was changed to alanine (p.S62A) using an sgRNA (targeting GGAACTTACAACCATGCTGA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.S68A mutation and prevents phosphorylation of the residue. (J:328357)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count