A Lmx1b-binding sites containing Lmx1b enhancer and suppressor region, regulating expression in limbs, was targeted with sgRNAs (targeting TGGTCCCCAGATATTATGG and GGTCGGCACTGTAAATGTTG) using CRISPR/Cas9 technology, resulting in a deletion. The deleted region contains enhancer Rr263 and suppressor Rr264. (J:312494)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count