Sequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was replaced with the same length (1324 bp) orthologous king cobra sequence (12,740-14,063 (589,507-590,830 (Ophiophagus hannah scaffold183.1; Genebank ID AZIM01000183.1)) using an sgRNA (targeting AGTACCATGCGTGTGTGTGA) and a plasmid DNA template with CRISPR/Cas9 technology. (J:316049)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count