Sequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was replaced with a modified version of the orthologous Burmese python sequence (JH127332:522,984-524,307 (latCha1)) using an sgRNA (targeting AGTACCATGCGTGTGTGTGA) and a plasmid DNA template with CRISPR/Cas9 technology. The modification involves "resurrecting" the snake sequence to be similar to other vertebrates by inserting the 17 bases (CTGAGGTAACTTCCTTG, overlapping an ETS1 binding site) missing in snakes. (J:316049)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count