The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 368 bp deletion. The allele was created in zygotes containing the Zeb2tm2.1Yhi allele. (J:316113)
Basic Information
STOCK Zeb2tm2.1Yhi/2YhiRbrc
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count