Smim17^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAACACTAGAAAGAGAGCA and ATAGACTGTGCATATCCACA, which resulted in a 7666 bp deletion beginning at Chromosome 7 position 6,427,547 bp and ending after 6,435,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001308241, ENSMUSE00001279438, ENSMUSE00000864604 (exons 2, 3, and 4) and 4539 bp of intronic sequence including the splice acceptor and donor the start site and 3 UTR and is predicted to result in a null allele. There is a 3 bp deletion (GTC) 5 bases after the 3 coordinate. (J:188991)