This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCTTGCAGTGAAGTGTAA and CTGAGCAGTGTTTATGTGAA, which resulted in a 327 bp deletion beginning at Chromosome 11 position 62,883,597 bp and ending after 62,883,923 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289657 (exon 3) and 182 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 5 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count