This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAATCTCTGAATTCAGAGA and AGATGCTAATGAAGTAATGC, which resulted in a 2174 bp deletion beginning at Chromosome 7 position 12,415,086 bp and ending after 12,417,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000479797 (exon 4) and 108 bp of flanking intronic sequence including the splice acceptor and 3 UTR and is predicted to cause a change of amino acid sequence after residue 88 and truncation 20 amino acids later by run on translation. There is a 3 bp insertion ATT at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count