Stx17^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTACCAATTGTCTTCTACA and GCAACGACAAGGATTTACAA, which resulted in a 434 bp deletion beginning at Chromosome 4 position 48,158,693 bp and ending after 48,159,126 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374906 (exon 4) and 211 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 63 and early truncation 14 amino acids later. (J:188991)