This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGTGGACTTGAGACCCC and GTAACTTGATCAATTTAGAG, which resulted in a 4121 bp deletion beginning at Chromosome 9 position 108,447,537 bp and ending after 108,451,657 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000221526, ENSMUSE00000221528, ENSMUSE00000243289, ENSMUSE00000221530 and ENSMUSE00000221531 (exons 2-6) and 2120 bp of flanking and intronic sequence including the start site, splice acceptors, donors as well as 3 UTR and is predicted to result in a null allele. There is a 4 bp insertion ACCT at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count