This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTACTGGTAGAAGTGGACCT and GGCAGTCTACTGTATTCCAA, which resulted in a 1866 bp deletion beginning at Chromosome 15 position 102,147,772 bp and ending after 102,149,637 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000285923, ENSMUSE00000133145, and ENSMUSE00000444314 (exons 2-4) and 1277 bp of flanking intronic sequence including the splice acceptor, donor as well as 3UTR is predicted to cause a change of amino acid sequence after residue 112 and early truncation 16 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count