This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTGTGGCTACATAGGGGA and AATTCTGCTTGGAGAAGTGA, which resulted in a 3638 bp deletion beginning at Chromosome 15 position 85,050,459 bp and ending after 85,054,096 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126537 and ENSMUSE00000126531 (exons 5 and 6) and 3223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 50 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count