This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGCTATTTAAAGCGCTG and ATACCCGGCCCGGCTAACAA, which resulted in a 3243 bp deletion beginning at Chromosome 15 position 98,167,142 bp and ending after 98,170,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409713 (exon 1) and 266 bp of flanking sequence including the splice acceptor and donor and start site as well as 3UTR and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count