Pgpep1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTAGTGTGGACCATAGCG and TCCAGGCGTGTGATTCTTGG, which resulted in a 13601 bp deletion beginning at Chromosome 8 position 70,646,368 bp and ending after 70,659,968 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349254, ENSMUSE00000213761, ENSMUSE00000213760, ENSMUSE00000437318 and ENSMUSE00000437329 (exons 1-5) and 8718 bp of intronic sequence including the start site, splice acceptor and donor as well as 3UTR and is predicted to result in a null allele. (J:188991)