This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CTAAGGCGAACAGCCTTCTG and GCTGGTCGTGTGGATCAGTG, which resulted in a 2081 bp deletion beginning at Chromosome 8 position 105,708,250 bp and ending after 105,710,330 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214417, ENSMUSE00000214420, ENSMUSE00000214418 and ENSMUSE00000214419 (exons 1, 2, 3 and 4) and 867 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count