This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATCCATACTACAATGCAC and CACTTAGCTGATCTCAGCAG, which resulted in a 3391 bp deletion beginning at Chromosome 12 position 30,886,935 bp and ending after 30,890,325 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435238, ENSMUSE00000435234 and ENSMUSE00000435241(exons 2, 3 and 4) and 3190 bp of intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 6 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count