This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CCACATCTAATGGCACTGAA and AGGACTATAAAACCCGACGA, which resulted in a 1214 bp deletion beginning at Chromosome 2 position 181,696,645 bp and ending after 181,697,858 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000399911, ENSMUSE00000359021 and ENSMUSE00000388487 (exons 2,3 and 4) and 532 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count