This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCGTCACCAAAATTACTGCA and CCTTCCTCACGCCATCCCTA, which resulted in a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256838 and ENSMUSE00000698574 (exons 3,4) and 4115 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. There is a 2 bp (CT) insertion at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count