Fam163b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTGCCTGAAGGTGCCCAG and TCTCTACAAGACCATCAAGA, which resulted in a 3410 bp deletion beginning at Chromosome 2 position 27,110,337 bp and ending after 27,113,746 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000851960 and ENSMUSE00000737448 (exons 2 and 3) and 783 bp of intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)