A total of six copies of a 40 bp sequence around the Rr29Hx mutation (TTTCCAACAATTTATGGATCATTAGTGGCAAAAAAAACAA) of the mouse MFCS1 (Rr29) SSh enhancer were placed up- and downstream of an hsp68 promoter and lacZ beta-galactosidase reporter gene cassette. (J:320682)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count