CRISPR/cas9 genome editing using guide RNAs [AGACCCCAAACAAGCAAATC; ACAGCCAGATTTGCTTGTTT; and CAGCCAGATTTGCTTGTTTG] selected to target exon 4. Donor DNAs were created encoding an I151F point mutation (ATC to TTC) and a T146T silent mutation (ACC to ACT), which was introduced to destroy the PAM recognition site. Fxn transcript Fxn-201 is used as reference for the exon numbering and the guide/donor sequences. The I151F point mutation corresponds to the human I154F mutation associated with Friedreich's Ataxia. (J:326677)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count