A guide RNA (TTAGCTGACTTTACATAGAG) is designed to fuse the NanoLuciferase-P2A-TdTomato (NLucTom) construct with the C-terminus, immediately before the stop codon, of the gene. Because of this guide RNA, 18bp of the 3'UTR directly downstream of the STOP codon has been deleted. Specifically, the construct contained (from 5' to 3') NLuc, a P2A ribosomal skip cleavage peptide sequence, and a constitutively fluorescent monoclonal orange fluorescent protein (tdTomato) reporter sequence. (J:326514)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count