CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing is used to insert an mCherry reporter in-frame before the termination codon. A combination of two sgRNAs (sgRNA1 ATTCTTATAGAGGACGCACT and sgRNA2 AAGTGCGTCCTCTATAAGAA or sgRNA1 and sgRNA3 AACATTGTGGTGGCTGATAT) is used to traget the junction between exon 4 and the 3' untranslated region (UTR). (J:302430)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count