Using sgRNAs (targeting GCCGTTCTTCCTAATGTGCA and GGAAGTGTCAACATCACCAG) and two ssODN templates with CRISPR/Cas9 technology, loxP sites were inserted at chr19:33198267 and 33202330 (GRCm39) to flank the Pten enhancer, located in intron 4 of Rnls, with loxP sites. (J:320472)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count