Using an sgRNA (targeting GCACTGAAGAGAATTGCATCTGG) and an ssODN templates (CTGCTGGATTACTCGTCCAGATGCAATTCTCTTCAGTGCTAGACAGTTTC) with CRISPR technology, 3' UTR mutation c.*171T>A (minor allele of SNP rs3654376) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. (J:323200)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count