Using an sgRNA (targeting ) and an ssODN template (GTCCAGCCCGTGGCCTCTCACCTGATAATTGCCAAGGGAATGAAGTACACCAGAAAGGCGACGATGGTCATGTACGGGGTCCAGTGCGAGTCATCCGGCCACAGTGCCCAGCACTGCACCTCACCATTGGAAAGTGTCCTTTTCCCAAATATGATCAGCGTGGGAATGGAGA) with CRISPR/Cas9 technology, tyrosine codon 206 (TAC) was changed to histidine (CAC) (p.Y206H). This mutation is located in a highly conserved extra-cellular domain and the equivalent mutation in humans is associated with familial natural short sleep (FNSS). (J:325012)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count