Alanine codon 232 (GCG) was changed to glutamic acid (GAG) (p.A232E) using an sgRNA (targeting CCTGCGCTGTTTAAGGCGATTGG) and an ssODN template (AGATAAAGGAGATGGTGGAGCTGCCACTGAGACATCCTGCACTGTTTAAAGAGATTGGTGTAAAGGTGAGTATCCTAAGGTCTGTGGGGAGTCT) with CRISPR/Cas9 technology. The gain-of-function mutation is located in the D1 ATPase domain of the encoded peptide and is associated with multisystem proteinopathy in humans. (J:325062)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count