CRISPR/Cas9 technology, using sgRNAs (targeting AACCTCAGGGACTCTCTCTG and GAAGTCTAGTTCCATTGCTG), generated a 993 bp deletion in exon 6 (GRCm39:chr8:84893258-84894251), leading to the deletion of 331 codons and an arginine to threonine codon change at codon 142 at the deletion junction (p.Arg142_Ala473delinsThr). Western blot analysis confirmed absence of protein. (J:303558)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count